ncbi primer-blast Search Results


90
STAB VIDA ncbi primer blast
Ncbi Primer Blast, supplied by STAB VIDA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+primer-blast/ncbi+primer+blast/pmc11188365-59-7-13
Average 90 stars, based on 1 article reviews
ncbi primer blast - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Microsynth ag ncbi primer-blast software
Ncbi Primer Blast Software, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+primer-blast/ncbi+primer+blast+software/pm37904253-168-9-23
Average 90 stars, based on 1 article reviews
ncbi primer-blast software - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
STAB VIDA ncbi primer-blast online tool
Ncbi Primer Blast Online Tool, supplied by STAB VIDA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+primer-blast/ncbi+primer+blast+online+tool/pmc09912517-102-5-13
Average 90 stars, based on 1 article reviews
ncbi primer-blast online tool - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Biolegio bv ncbi primer blast software
Ncbi Primer Blast Software, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+primer-blast/ncbi+primer+blast/pm24799273-92-5-12
Average 90 stars, based on 1 article reviews
ncbi primer blast software - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Merck KGaA primer3 software
Primer3 Software, supplied by Merck KGaA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+primer-blast/ncbi+primer+blast+software/pmc10376771-61-7-15
Average 90 stars, based on 1 article reviews
primer3 software - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Metabion International AG online software primer-blast
Online Software Primer Blast, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+primer-blast/ncbi+primer+blast+tool/pmc09898505-297-12-16
Average 90 stars, based on 1 article reviews
online software primer-blast - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
PrimerDesign Inc ncbi primerblast
Ncbi Primerblast, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+primer-blast/ncbi+primerblast/pmc03564122-206-7-13
Average 90 stars, based on 1 article reviews
ncbi primerblast - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Microsynth ag ncbi-primer-blast webserver
Ncbi Primer Blast Webserver, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+primer-blast/ncbi+primer+blast+webserver/pm32820213-298-5-11
Average 90 stars, based on 1 article reviews
ncbi-primer-blast webserver - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Microsynth ag ncbi primerblast tool
Ncbi Primerblast Tool, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+primer-blast/ncbi+primerblast+tool/pmc09219657-86-7-14
Average 90 stars, based on 1 article reviews
ncbi primerblast tool - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
BGI Genomics Co ncbi primer-blast
Ncbi Primer Blast, supplied by BGI Genomics Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+primer-blast/ncbi+primer+blast/pm39695364-111-4-12
Average 90 stars, based on 1 article reviews
ncbi primer-blast - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
GeneWorks ncbi primer blast software
Ncbi Primer Blast Software, supplied by GeneWorks, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+primer-blast/ncbi+primer+blast+software/pm29330684-63-9-29
Average 90 stars, based on 1 article reviews
ncbi primer blast software - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
GenomeScan ncbi primer blast
Four different GBA1 primer sets that will lead to amplification of the functional gene and not the pseudogene GBAP1.
Ncbi Primer Blast, supplied by GenomeScan, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+primer-blast/ncbi+primer+blast/pmc07794395-37-0-3
Average 90 stars, based on 1 article reviews
ncbi primer blast - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results


Four different GBA1 primer sets that will lead to amplification of the functional gene and not the pseudogene GBAP1.

Journal: Scientific Reports

Article Title: False negatives in GBA1 sequencing due to polymerase dependent allelic imbalance

doi: 10.1038/s41598-020-80564-y

Figure Lengend Snippet: Four different GBA1 primer sets that will lead to amplification of the functional gene and not the pseudogene GBAP1.

Article Snippet: 4 Designed by GenomeScan using NCBI primer blast , GBA_P4_F , AGAAGTTGATCCCGGTGCTG , chr1: 155202617.

Techniques: Amplification, Functional Assay, Sequencing